Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTGCCCTTGGGCCTGCCACTGT[C/T]TCCTCTCACTGATGGTTCCATCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613478 MIM: 191318 | ||||||||||||||||||||
Literature Links: |
CCDC106 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC106 - coiled-coil domain containing 106 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013301.2 | Intron | NP_037433.2 | ||||
XM_005258827.2 | Intron | XP_005258884.1 | ||||
XM_005258828.2 | Intron | XP_005258885.1 |
LOC107983998 - uncharacterized LOC107983998 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
U2AF2 - U2 small nuclear RNA auxiliary factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF580 - zinc finger protein 580 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF581 - zinc finger protein 581 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |