Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCAGCCTGGGGGGGCCACCGGCA[A/C]AACAGTCGTCCAGTGTCAGGGATCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616442 MIM: 180662 MIM: 601303 MIM: 613583 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
OVOL3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
OVOL3 - ovo like zinc finger 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302757.1 | 124 | Missense Mutation | AAA,CAA | K,Q 42 | NP_001289686.1 | |
XM_011527251.2 | 124 | UTR 5 | XP_011525553.1 | |||
XM_017027190.1 | 124 | Missense Mutation | AAA,CAA | K,Q 66 | XP_016882679.1 | |
XM_017027191.1 | 124 | Missense Mutation | AAA,CAA | K,Q 42 | XP_016882680.1 |
POLR2I - RNA polymerase II subunit I | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBCB - tubulin folding cofactor B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR62 - WD repeat domain 62 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083961.1 | 124 | Intron | NP_001077430.1 | |||
NM_173636.4 | 124 | Intron | NP_775907.4 | |||
XM_005258809.2 | 124 | Intron | XP_005258866.1 | |||
XM_011526837.1 | 124 | Intron | XP_011525139.1 | |||
XM_011526838.1 | 124 | Intron | XP_011525140.1 | |||
XM_011526839.1 | 124 | Intron | XP_011525141.1 | |||
XM_011526840.2 | 124 | Intron | XP_011525142.1 | |||
XM_011526841.2 | 124 | Intron | XP_011525143.1 | |||
XM_011526842.1 | 124 | Intron | XP_011525144.1 | |||
XM_011526843.1 | 124 | Intron | XP_011525145.1 | |||
XM_011526844.2 | 124 | Intron | XP_011525146.1 | |||
XM_017026665.1 | 124 | Intron | XP_016882154.1 |