Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGGCTGTCCATGGCATTGGTCCC[C/T]ACCTGTAGCCATGGAGAAGTGGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615620 MIM: 603215 | ||||||||||||||||||||
Literature Links: |
KPTN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KPTN - kaptin, actin binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAPA - NSF attachment protein alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003827.3 | 556 | Silent Mutation | GTA,GTG | V,V 188 | NP_003818.2 | |
XM_011527436.1 | 556 | Silent Mutation | GTA,GTG | V,V 138 | XP_011525738.1 | |
XM_011527437.1 | 556 | Silent Mutation | GTA,GTG | V,V 84 | XP_011525739.1 |
NAPA-AS1 - NAPA antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |