Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCTGATGTTGAATCAACTGAGAA[C/T]GATGACTAAAGGTTTTCCCACATTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615600 | ||||||||||||||||||||
Literature Links: |
ZNF542P PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ZNF542P - zinc finger protein 542, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF582 - zinc finger protein 582 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320371.1 | 1208 | Missense Mutation | CAT,CGT | H,R 354 | NP_001307300.1 | |
NM_144690.2 | 1208 | Missense Mutation | CAT,CGT | H,R 323 | NP_653291.1 |
ZNF582-AS1 - ZNF582 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |