Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTAACACCAGCTCCCGCTGGGAC[G/T]GAACAGGGAAGGCTGTGCTTTGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610875 | ||||||||||||||||||||
Literature Links: |
MIR6802 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6802 - microRNA 6802 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6804 - microRNA 6804 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP6R1 - protein phosphatase 6 regulatory subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014931.3 | 3245 | UTR 3 | NP_055746.3 |
TMEM86B - transmembrane protein 86B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173804.4 | 3245 | Intron | NP_776165.3 | |||
XM_017026554.1 | 3245 | Intron | XP_016882043.1 |