Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGATGGACCCATACAGCGCTTTGA[C/T]AAGTGCCTGGAAGAGTTCTATGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612914 MIM: 610506 | ||||||||||||||||||||
Literature Links: |
MED29 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MED29 - mediator complex subunit 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317770.1 | 429 | Silent Mutation | GAC,GAT | D,D 124 | NP_001304699.1 | |
NM_017592.2 | 429 | Silent Mutation | GAC,GAT | D,D 124 | NP_060062.1 |
PAF1 - PAF1 homolog, Paf1/RNA polymerase II complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SAMD4B - sterile alpha motif domain containing 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |