Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCTGGTCGTACACCAGGTAGAC[A/G]GCGCCCCCAGCCACACTTCCCTTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616658 | ||||||||||||||||||||
Literature Links: |
C19orf70 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf70 - chromosome 19 open reading frame 70 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308240.1 | 669 | Silent Mutation | GCC,GCT | A,A 43 | NP_001295169.1 | |
NM_205767.2 | 669 | Silent Mutation | GCC,GCT | A,A 21 | NP_991330.1 | |
XM_011527675.2 | 669 | Silent Mutation | GCC,GCT | A,A 43 | XP_011525977.1 | |
XM_017026248.1 | 669 | Silent Mutation | GCC,GCT | A,A 43 | XP_016881737.1 |
HSD11B1L - hydroxysteroid 11-beta dehydrogenase 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107985320 - uncharacterized LOC107985320 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |