Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCAGCTATGCCAAAAAAGTTGC[A/G]CTCTGGCTTGCTGGGCTGCTTGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602102 MIM: 607381 | ||||||||||||||||||||
Literature Links: |
SUPT5H PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SUPT5H - SPT5 homolog, DSIF elongation factor subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIMM50 - translocase of inner mitochondrial membrane 50 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011527491.2 | 209 | Silent Mutation | GCA,GCG | A,A 55 | XP_011525793.1 | |
XM_017027472.1 | 209 | UTR 5 | XP_016882961.1 |