Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCATCTTCCTGCTGATGCTTATCCT[C/T]CTGGGGAAGGGATTCACGGTGACAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604267 | ||||||||||||||||||||
Literature Links: |
MEGF8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MEGF8 - multiple EGF like domains 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRR19 - proline rich 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM145 - transmembrane protein 145 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173633.2 | 874 | Silent Mutation | CTC,CTT | L,L 260 | NP_775904.2 | |
XM_005258781.4 | 874 | Silent Mutation | CTC,CTT | L,L 274 | XP_005258838.1 | |
XM_011526791.2 | 874 | Silent Mutation | CTC,CTT | L,L 260 | XP_011525093.1 | |
XM_011526792.1 | 874 | Silent Mutation | CTC,CTT | L,L 274 | XP_011525094.1 |