Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTGGAAGTCTGGAGTCTCCAGGT[A/G]GGCCTGGCACGTCAGCGTCACATTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138670 | ||||||||||||||||||||
Literature Links: |
A1BG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
A1BG - alpha-1-B glycoprotein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_130786.3 | 216 | Missense Mutation | CAC,TAC | H,Y 52 | NP_570602.2 |
A1BG-AS1 - A1BG antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100419840 - zinc finger protein 446 pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105372483 - uncharacterized LOC105372483 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF497 - zinc finger protein 497 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |