Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCTCCAGACCCAAGGTGGCAGCT[C/G]TCACTGCGGGGACCCTGCTACTTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142440 MIM: 600235 | ||||||||||||||||||||
Literature Links: |
HPN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HPN - hepsin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002151.2 | 260 | Missense Mutation | CTC,GTC | L,V 21 | NP_002142.1 | |
NM_182983.2 | 260 | Missense Mutation | CTC,GTC | L,V 21 | NP_892028.1 | |
XM_005258838.4 | 260 | Missense Mutation | CTC,GTC | L,V 21 | XP_005258895.2 | |
XM_006723181.3 | 260 | Missense Mutation | CTC,GTC | L,V 21 | XP_006723244.2 | |
XM_017026731.1 | 260 | Missense Mutation | CTC,GTC | L,V 21 | XP_016882220.1 | |
XM_017026732.1 | 260 | UTR 5 | XP_016882221.1 |
HPN-AS1 - HPN antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCN1B - sodium voltage-gated channel beta subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |