Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCTGTCCCGCGGGGCCTCGGGCA[C/T]CCAGGGCCTGGCCAGGTGAGCTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 114212 MIM: 603327 | ||||||||||||||||||||
Literature Links: |
CAPS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CAPS - calcyphosine | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004058.4 | 756 | Missense Mutation | ACC,ATC | T,I 109 | NP_004049.2 | |
NM_080590.3 | 756 | Missense Mutation | ACC,ATC | T,I 109 | NP_542157.2 |
RANBP3 - RAN binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VMAC - vimentin-type intermediate filament associated coiled-coil protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |