Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGGCCTTTAAACTTTGGTATGAA[A/G]GGAGCTTCCACCTGGAGAGGGATCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601639 | ||||||||||||||||||||
Literature Links: |
C19orf67 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf67 - chromosome 19 open reading frame 67 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRKACA - protein kinase cAMP-activated catalytic subunit alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304349.1 | 1576 | Silent Mutation | CCC,CCT | P,P 390 | NP_001291278.1 | |
NM_002730.3 | 1576 | Silent Mutation | CCC,CCT | P,P 314 | NP_002721.1 | |
NM_207518.2 | 1576 | Intron | NP_997401.1 | |||
XM_017026948.1 | 1576 | Intron | XP_016882437.1 |
SAMD1 - sterile alpha motif domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |