Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCTGGCCAGATTTGGACGCATC[A/G]GTCGCCTGGTCCTGCGCGCCTGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609169 MIM: 609969 MIM: 613585 | ||||||||||||||||||||
Literature Links: |
GAPDHS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GAPDHS - glyceraldehyde-3-phosphate dehydrogenase, spermatogenic | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014364.4 | 271 | Missense Mutation | AGT,GGT | S,G 87 | NP_055179.1 | |
XM_017026579.1 | 271 | Missense Mutation | AGT,GGT | S,G 86 | XP_016882068.1 |
SBSN - suprabasin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM147 - transmembrane protein 147 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM147-AS1 - TMEM147 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |