Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTGGACCTGTTGGACAGATATGT[A/G]AAGTTCGTGAAAGAACGCACCGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604504 | ||||||||||||||||||||
Literature Links: |
GPR108 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPR108 - G protein-coupled receptor 108 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6791 - microRNA 6791 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIP10 - thyroid hormone receptor interactor 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288962.1 | 167 | Silent Mutation | GTA,GTG | V,V 29 | NP_001275891.1 | |
NM_001288963.1 | 167 | Silent Mutation | GTA,GTG | V,V 29 | NP_001275892.1 | |
NM_004240.3 | 167 | Silent Mutation | GTA,GTG | V,V 29 | NP_004231.1 | |
XM_005259683.2 | 167 | Silent Mutation | GTA,GTG | V,V 29 | XP_005259740.1 | |
XM_006722940.1 | 167 | Silent Mutation | GTA,GTG | V,V 29 | XP_006723003.1 |