Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCATCGGGGCCCCAGCCCTGTCCC[A/G]GCTGCAGGGACAGGAGCAGCAGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613305 MIM: 601119 MIM: 189968 MIM: 602921 | ||||||||||||||||||||
Literature Links: |
ALKBH7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALKBH7 - alkB homolog 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032306.3 | Intron | NP_115682.1 | ||||
XM_005259658.4 | Intron | XP_005259715.1 | ||||
XM_017027355.1 | Intron | XP_016882844.1 |
CLPP - caseinolytic mitochondrial matrix peptidase proteolytic subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GTF2F1 - general transcription factor IIF subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSPN - persephin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |