Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCCTTTGGCCACCGCTCCAAGCT[A/G]GCGGCTCACCTCTGGACCCACGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608451 MIM: 194360 | ||||||||||||||||||||
Literature Links: |
ETHE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ETHE1 - ETHE1, persulfide dioxygenase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
XRCC1 - X-ray repair cross complementing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF575 - zinc finger protein 575 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_174945.2 | 672 | Silent Mutation | CTA,CTG | L,L 134 | NP_777605.1 | |
XM_005258783.3 | 672 | Silent Mutation | CTA,CTG | L,L 134 | XP_005258840.1 | |
XM_011526793.2 | 672 | Silent Mutation | CTA,CTG | L,L 134 | XP_011525095.1 |