Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAGAGCCAACAGACTTCCTGAGC[C/T]GCCTTCGAAGATGTCTTCCCTGCTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610837 MIM: 603734 MIM: 602950 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BCL2L12 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BCL2L12 - BCL2 like 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040668.1 | 1079 | Missense Mutation | CGC,TGC | R,C 132 | NP_001035758.1 | |
NM_001282516.1 | 1079 | Missense Mutation | CGC,TGC | R,C 133 | NP_001269445.1 | |
NM_001282517.1 | 1079 | Intron | NP_001269446.1 | |||
NM_001282519.1 | 1079 | Missense Mutation | CGC,TGC | R,C 133 | NP_001269448.1 | |
NM_001282520.1 | 1079 | Missense Mutation | CGC,TGC | R,C 133 | NP_001269449.1 | |
NM_001282521.1 | 1079 | Missense Mutation | CGC,TGC | R,C 133 | NP_001269450.1 | |
NM_138639.1 | 1079 | Missense Mutation | CGC,TGC | R,C 133 | NP_619580.1 | |
XM_017027345.1 | 1079 | Missense Mutation | CGC,TGC | R,C 132 | XP_016882834.1 | |
XM_017027346.1 | 1079 | Intron | XP_016882835.1 |
IRF3 - interferon regulatory factor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRMT1 - protein arginine methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAF1 - SR-related CTD associated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |