Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGGTTCCAGGGCTGGGACTCTGGC[A/G]TCCTGCTCCTCCATCAACACCAACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613304 MIM: 607382 MIM: 615535 | ||||||||||||||||||||
Literature Links: |
ALKBH6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALKBH6 - alkB homolog 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297701.1 | 152 | Silent Mutation | GAC,GAT | D,D 5 | NP_001284630.1 | |
NM_032878.3 | 152 | Silent Mutation | GAC,GAT | D,D 33 | NP_116267.3 | |
NM_198867.1 | 152 | Silent Mutation | GAC,GAT | D,D 33 | NP_942567.1 | |
XM_005259357.4 | 152 | Silent Mutation | GAC,GAT | D,D 5 | XP_005259414.1 |
CLIP3 - CAP-Gly domain containing linker protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927572 - uncharacterized LOC101927572 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNE4 - spectrin repeat containing nuclear envelope family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |