Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCGGTAGTGGGACAGCTCCTGGCG[C/T]ACGGCCACAACTTCCTGCCGCAGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604644 MIM: 124097 MIM: 607092 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CA11 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CA11 - carbonic anhydrase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DBP - D-box binding PAR bZIP transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001352.4 | 1166 | Silent Mutation | GTA,GTG | V,V 304 | NP_001343.2 | |
XM_017026388.1 | 1166 | Silent Mutation | GTA,GTG | V,V 161 | XP_016881877.1 |
SEC1P - secretory blood group 1, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPHK2 - sphingosine kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204158.2 | 1166 | Intron | NP_001191087.1 | |||
NM_001204159.2 | 1166 | Intron | NP_001191088.1 | |||
NM_001204160.2 | 1166 | Intron | NP_001191089.1 | |||
NM_001243876.1 | 1166 | Intron | NP_001230805.1 | |||
NM_020126.4 | 1166 | Intron | NP_064511.2 | |||
XM_006723292.1 | 1166 | Intron | XP_006723355.1 | |||
XM_011527133.1 | 1166 | Intron | XP_011525435.1 | |||
XM_011527134.1 | 1166 | Intron | XP_011525436.1 | |||
XM_017027008.1 | 1166 | Intron | XP_016882497.1 | |||
XM_017027009.1 | 1166 | Intron | XP_016882498.1 | |||
XM_017027010.1 | 1166 | Intron | XP_016882499.1 |