Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGAACTGGCTCACCTGAGGCTTC[C/T]GGAGCAGGGAGTGTCTTTGGTGACG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613304 MIM: 607382 MIM: 612848 MIM: 615535 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ALKBH6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ALKBH6 - alkB homolog 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLIP3 - CAP-Gly domain containing linker protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927572 - uncharacterized LOC101927572 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SDHAF1 - succinate dehydrogenase complex assembly factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNE4 - spectrin repeat containing nuclear envelope family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039876.2 | 735 | Missense Mutation | CAG,CGG | Q,R 321 | NP_001034965.1 | |
NM_001297735.2 | 735 | Missense Mutation | CAG,CGG | Q,R 208 | NP_001284664.1 |