Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCGCTCGCCGCACTCGACGCAGC[C/G]AAAGGACTTGTCGCCCGTGTGTACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610893 MIM: 194550 MIM: 603173 | ||||||||||||||||||||
Literature Links: |
CHMP2A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHMP2A - charged multivesicular body protein 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MZF1 - myeloid zinc finger 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267033.1 | 2456 | UTR 3 | NP_001253962.1 | |||
NM_003422.2 | 2456 | Missense Mutation | CGC,GGC | R,G 514 | NP_003413.2 | |
NM_198055.1 | 2456 | Missense Mutation | CGC,GGC | R,G 514 | NP_932172.1 | |
XM_005259204.3 | 2456 | Missense Mutation | CGC,GGC | R,G 555 | XP_005259261.1 | |
XM_011527264.2 | 2456 | Missense Mutation | CGC,GGC | R,G 544 | XP_011525566.1 | |
XM_017027206.1 | 2456 | Missense Mutation | CGC,GGC | R,G 230 | XP_016882695.1 |
MZF1-AS1 - MZF1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBE2M - ubiquitin conjugating enzyme E2 M | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |