Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAAATCGCTCCTTGCCGAGAAGCA[A/G]AACTGGCTCCAGCAGCTAAAGGAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611893 MIM: 603675 | ||||||||||||||||||||
Literature Links: |
LOC723805 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC723805 - interleukin-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHG2 - pleckstrin homology and RhoGEF domain containing G2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS16 - ribosomal protein S16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001020.5 | 240 | Silent Mutation | CTG,TTG | L,L 56 | NP_001011.1 | |
NM_001321111.1 | 240 | Silent Mutation | CTG,TTG | L,L 39 | NP_001308040.1 | |
XM_005259137.2 | 240 | Intron | XP_005259194.1 |