Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTTCAACTCCTGAAAATCAATCA[A/G]TTGAGCCCTACCTTTACCAGACCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
28 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608862 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GPATCH4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GPATCH4 - G-patch domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015590.3 | 1423 | UTR 3 | NP_056405.2 | |||
NM_182679.2 | 1423 | UTR 3 | NP_872620.1 | |||
XM_005245287.3 | 1423 | UTR 3 | XP_005245344.1 |
HAPLN2 - hyaluronan and proteoglycan link protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAXE - NAD(P)HX epimerase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144772.2 | 1423 | Intron | NP_658985.2 | |||
XM_017000319.1 | 1423 | Intron | XP_016855808.1 |
TTC24 - tetratricopeptide repeat domain 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |