Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGAAACAGGCATCTGCCCTGTCC[A/G]CAGGGAACTCTACTCACAGTGTTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602135 MIM: 609365 MIM: 608241 | ||||||||||||||||||||
Literature Links: |
DNALI1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNALI1 - dynein axonemal light intermediate chain 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003462.3 | 447 | Missense Mutation | CAC,CGC | H,R 146 | NP_003453.2 | |
XM_005271172.2 | 447 | Intron | XP_005271229.1 |
GNL2 - G protein nucleolar 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNIP1 - Smad nuclear interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |