Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGGGAAATGAGAAATCGAAGGAA[C/T]TGGCCCAATGGCGAGGAGAGGAAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 107670 MIM: 603881 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
APOA2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
APOA2 - apolipoprotein A2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5187 - microRNA 5187 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NR1I3 - nuclear receptor subfamily 1 group I member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077469.2 | 2602 | Intron | NP_001070937.1 | |||
NM_001077470.2 | 2602 | Intron | NP_001070938.1 | |||
NM_001077471.2 | 2602 | Intron | NP_001070939.1 | |||
NM_001077472.2 | 2602 | Intron | NP_001070940.1 | |||
NM_001077473.2 | 2602 | Intron | NP_001070941.1 | |||
NM_001077474.2 | 2602 | Intron | NP_001070942.1 | |||
NM_001077475.2 | 2602 | Intron | NP_001070943.1 | |||
NM_001077476.2 | 2602 | Intron | NP_001070944.1 | |||
NM_001077477.2 | 2602 | Intron | NP_001070945.1 | |||
NM_001077478.2 | 2602 | Intron | NP_001070946.1 | |||
NM_001077479.2 | 2602 | Intron | NP_001070947.1 | |||
NM_001077480.2 | 2602 | Intron | NP_001070948.1 | |||
NM_001077481.2 | 2602 | Intron | NP_001070949.1 | |||
NM_001077482.2 | 2602 | Intron | NP_001070950.1 | |||
NM_005122.4 | 2602 | Intron | NP_005113.1 | |||
XM_005245693.4 | 2602 | Intron | XP_005245750.1 | |||
XM_005245694.4 | 2602 | Intron | XP_005245751.1 | |||
XM_005245697.4 | 2602 | Intron | XP_005245754.1 | |||
XM_011510237.2 | 2602 | Intron | XP_011508539.1 |
TOMM40L - translocase of outer mitochondrial membrane 40 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286373.1 | 2602 | UTR 3 | NP_001273302.1 | |||
NM_001286374.1 | 2602 | UTR 3 | NP_001273303.1 | |||
NM_032174.5 | 2602 | UTR 3 | NP_115550.2 | |||
XM_006711572.2 | 2602 | UTR 3 | XP_006711635.1 | |||
XM_011510057.2 | 2602 | UTR 3 | XP_011508359.1 | |||
XM_017002481.1 | 2602 | UTR 3 | XP_016857970.1 | |||
XM_017002482.1 | 2602 | UTR 3 | XP_016857971.1 |