Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATGCTGCAAAATAGCACGATACC[A/G]TTACTATTACCTCATACCATTTGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
19 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 147586 MIM: 612677 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
IFI16 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
IFI16 - interferon gamma inducible protein 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206567.1 | Intron | NP_001193496.1 | ||||
NM_005531.2 | Intron | NP_005522.2 | ||||
XM_005245127.3 | Intron | XP_005245184.1 | ||||
XM_006711290.1 | Intron | XP_006711353.1 | ||||
XM_017001149.1 | Intron | XP_016856638.1 | ||||
XM_017001150.1 | Intron | XP_016856639.1 |
POP3 - pyrin domain-only protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PYHIN1 - pyrin and HIN domain family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152501.4 | Intron | NP_689714.2 | ||||
NM_198928.4 | Intron | NP_945146.1 | ||||
NM_198929.4 | Intron | NP_945147.1 | ||||
NM_198930.3 | Intron | NP_945148.1 | ||||
XM_005244930.1 | Intron | XP_005244987.1 | ||||
XM_011509242.2 | Intron | XP_011507544.1 | ||||
XM_011509243.2 | Intron | XP_011507545.1 | ||||
XM_017000463.1 | Intron | XP_016855952.1 |