Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCCCAGCCCCATGGACCACTCAC[A/G]CGACTCCCATTAGCACTCCTCCCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605077 MIM: 609917 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DMAP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DMAP1 - DNA methyltransferase 1 associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ERI3 - ERI1 exoribonuclease family member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301698.1 | Intron | NP_001288627.1 | ||||
NM_001301699.1 | Intron | NP_001288628.1 | ||||
NM_001301700.1 | Intron | NP_001288629.1 | ||||
NM_001301701.1 | Intron | NP_001288630.1 | ||||
NM_024066.2 | Intron | NP_076971.1 | ||||
XM_005271186.2 | Intron | XP_005271243.1 | ||||
XM_006710891.3 | Intron | XP_006710954.1 | ||||
XM_017002301.1 | Intron | XP_016857790.1 | ||||
XM_017002302.1 | Intron | XP_016857791.1 | ||||
XM_017002303.1 | Intron | XP_016857792.1 | ||||
XM_017002304.1 | Intron | XP_016857793.1 | ||||
XM_017002305.1 | Intron | XP_016857794.1 |
ERI3-IT1 - ERI3 intronic transcript 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |