Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTTGCCTTTTCCAGAACCCCCTAG[A/G]GTTGGAATCACAGTGTGTAGCATTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615183 MIM: 176982 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAAP20 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAAP20 - Fanconi anemia core complex associated protein 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146310.1 | Intron | NP_001139782.1 | ||||
NM_001256945.1 | Intron | NP_001243874.1 | ||||
NM_001256946.1 | Intron | NP_001243875.1 | ||||
NM_001256947.1 | Intron | NP_001243876.1 | ||||
NM_001282670.1 | Intron | NP_001269599.1 | ||||
NM_001282671.1 | Intron | NP_001269600.1 | ||||
NM_001282672.1 | Intron | NP_001269601.1 | ||||
NM_001282673.1 | Intron | NP_001269602.1 | ||||
NM_182533.2 | Intron | NP_872339.2 | ||||
XM_006710419.3 | Intron | XP_006710482.1 | ||||
XM_006710421.3 | Intron | XP_006710484.1 | ||||
XM_011540914.2 | Intron | XP_011539216.1 | ||||
XM_011540921.2 | Intron | XP_011539223.1 | ||||
XM_011540922.1 | Intron | XP_011539224.1 | ||||
XM_017000553.1 | Intron | XP_016856042.1 | ||||
XM_017000554.1 | Intron | XP_016856043.1 | ||||
XM_017000555.1 | Intron | XP_016856044.1 | ||||
XM_017000556.1 | Intron | XP_016856045.1 | ||||
XM_017000557.1 | Intron | XP_016856046.1 |
LOC100506504 - uncharacterized LOC100506504 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRKCZ - protein kinase C zeta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |