Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTAATACAGCATATTCCAATGGGG[A/T]ATCCCAGGAACCAAAAGACTAATTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 179710 MIM: 603238 MIM: 180645 MIM: 603239 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
RCC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
RCC1 - regulator of chromosome condensation 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048194.2 | Intron | NP_001041659.1 | ||||
NM_001048195.2 | Intron | NP_001041660.1 | ||||
NM_001048199.2 | Intron | NP_001041664.1 | ||||
NM_001269.4 | Intron | NP_001260.1 |
SNHG3 - small nucleolar RNA host gene 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA73A - small nucleolar RNA, H/ACA box 73A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA73B - small nucleolar RNA, H/ACA box 73B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |