Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTAGAATAACCAAAAAGCAGTGTC[A/G]GAAGCCAGAGCTACAGTCCCTTTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603185 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC17 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC17 - coiled-coil domain containing 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001114938.2 | Intron | NP_001108410.2 | ||||
NM_001190182.1 | Intron | NP_001177111.1 | ||||
XM_011540812.1 | Intron | XP_011539114.1 | ||||
XM_011540814.1 | Intron | XP_011539116.1 | ||||
XM_011540820.1 | Intron | XP_011539122.1 | ||||
XM_017000450.1 | Intron | XP_016855939.1 | ||||
XM_017000451.1 | Intron | XP_016855940.1 | ||||
XM_017000452.1 | Intron | XP_016855941.1 | ||||
XM_017000453.1 | Intron | XP_016855942.1 | ||||
XM_017000454.1 | Intron | XP_016855943.1 | ||||
XM_017000455.1 | Intron | XP_016855944.1 | ||||
XM_017000456.1 | Intron | XP_016855945.1 | ||||
XM_017000457.1 | Intron | XP_016855946.1 | ||||
XM_017000458.1 | Intron | XP_016855947.1 |
GPBP1L1 - GC-rich promoter binding protein 1 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NASP - nuclear autoantigenic sperm protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |