Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTTGAGCTCCTCCGAGCGTTCCA[C/T]CACCAGGGTCACTGGTCCTGGCAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
15 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600172 MIM: 612276 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C1orf122 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C1orf122 - chromosome 1 open reading frame 122 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142726.1 | 470 | Intron | NP_001136198.1 | |||
NM_198446.2 | 470 | Intron | NP_940848.2 |
MANEAL - mannosidase endo-alpha like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTF1 - metal regulatory transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YRDC - yrdC N6-threonylcarbamoyltransferase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024640.3 | 470 | Missense Mutation | ATG,GTG | M,V 153 | NP_078916.3 |