Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGCCTGGGCAGTGGGAGCCATCG[C/T]CTATGAAATCTTCGGGCTTGTCAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602202 MIM: 608309 | ||||||||||||||||||||
Literature Links: |
DDOST PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDOST - dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PINK1 - PTEN induced putative kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032409.2 | 1422 | Missense Mutation | GCC,GTC | A,V 443 | NP_115785.1 |
PINK1-AS - PINK1 antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |