Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTATTATACAGTCACCCCCAGTTAT[A/G]GTGAGTACATGAAAGGCTCTTGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607629 MIM: 604832 MIM: 615782 | ||||||||||||||||||||
Literature Links: |
APH1A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APH1A - aph-1 homolog A, gamma-secretase subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077628.2 | 279 | Intron | NP_001071096.1 | |||
NM_001243771.1 | 279 | Intron | NP_001230700.1 | |||
NM_001243772.1 | 279 | Intron | NP_001230701.1 | |||
NM_016022.3 | 279 | Intron | NP_057106.2 | |||
XM_017001417.1 | 279 | Intron | XP_016856906.1 |
C1orf54 - chromosome 1 open reading frame 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301039.1 | 279 | Missense Mutation | AAT,GAT | N,D 44 | NP_001287968.1 | |
NM_001301040.1 | 279 | Missense Mutation | AAT,GAT | N,D 44 | NP_001287969.1 | |
NM_001301041.1 | 279 | Intron | NP_001287970.1 | |||
NM_001301042.1 | 279 | Missense Mutation | AAT,GAT | N,D 44 | NP_001287971.1 | |
NM_024579.3 | 279 | Missense Mutation | AAT,GAT | N,D 44 | NP_078855.2 | |
XM_011509984.2 | 279 | Intron | XP_011508286.1 |
CA14 - carbonic anhydrase 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CIART - circadian associated repressor of transcription | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |