Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGGCTGCAGTGGCCCCGCTGTAG[C/T]GCAAGCTGACTGCCCCAGGCAGTAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 603876 MIM: 602985 | ||||||||||||||||||||
Literature Links: |
ADAMTS4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAMTS4 - ADAM metallopeptidase with thrombospondin type 1 motif 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320336.1 | 2544 | Silent Mutation | GCA,GCG | A,A 706 | NP_001307265.1 | |
NM_005099.5 | 2544 | Missense Mutation | CAC,CGC | H,R 760 | NP_005090.3 |
NDUFS2 - NADH:ubiquinone oxidoreductase core subunit S2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |