Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGATCCCAGATGGACGAGGTCGATG[C/G]GTAAAAGATGAAAATGTTGAGTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608095 MIM: 605834 MIM: 612112 MIM: 600607 | ||||||||||||||||||||
Literature Links: |
LYSMD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LYSMD1 - LysM domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCNM1 - sodium channel modifier 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204856.1 | 807 | Missense Mutation | TGC,TGG | C,W 174 | NP_001191785.1 | |
NM_024041.3 | 807 | Missense Mutation | TGC,TGG | C,W 209 | NP_076946.1 |
TMOD4 - tropomodulin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013353.2 | 807 | Intron | NP_037485.2 | |||
XM_011509449.1 | 807 | Intron | XP_011507751.1 | |||
XM_017001089.1 | 807 | Intron | XP_016856578.1 | |||
XM_017001090.1 | 807 | Intron | XP_016856579.1 |
TNFAIP8L2 - TNF alpha induced protein 8 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP8L2-SCNM1 - TNFAIP8L2-SCNM1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204848.1 | 807 | Missense Mutation | TGC,TGG | C,W 174 | NP_001191777.1 |
VPS72 - vacuolar protein sorting 72 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |