Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGATCCATCTCAAAGCATGAAAAG[G/T]CCAAATATGAAGCCCTGGCCAAACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608398 | ||||||||||||||||||||
Literature Links: |
CSMD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSMD2 - CUB and Sushi multiple domains 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281956.1 | 1915 | Intron | NP_001268885.1 | |||
NM_052896.4 | 1915 | Intron | NP_443128.2 | |||
XM_017000185.1 | 1915 | Intron | XP_016855674.1 | |||
XM_017000186.1 | 1915 | Intron | XP_016855675.1 | |||
XM_017000187.1 | 1915 | Intron | XP_016855676.1 | |||
XM_017000188.1 | 1915 | Intron | XP_016855677.1 | |||
XM_017000189.1 | 1915 | Intron | XP_016855678.1 | |||
XM_017000190.1 | 1915 | Intron | XP_016855679.1 | |||
XM_017000191.1 | 1915 | Intron | XP_016855680.1 | |||
XM_017000192.1 | 1915 | Intron | XP_016855681.1 | |||
XM_017000193.1 | 1915 | Intron | XP_016855682.1 | |||
XM_017000194.1 | 1915 | Intron | XP_016855683.1 |
CSMD2-AS1 - CSMD2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMGB4 - high mobility group box 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145205.5 | 1915 | Missense Mutation | GCC,TCC | A,S 58 | NP_660206.2 |