Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCACTCCCTAGTGGAAGAAATCA[A/C]ATCTGGGGGCATACATGTATTGAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611824 MIM: 605138 MIM: 609501 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MRPL9 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MRPL9 - mitochondrial ribosomal protein L9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OAZ3 - ornithine decarboxylase antizyme 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134939.1 | Intron | NP_001128411.1 | ||||
NM_001301371.1 | Intron | NP_001288300.1 | ||||
NM_016178.2 | Intron | NP_057262.2 |
TDRKH - tudor and KH domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083963.1 | Intron | NP_001077432.1 | ||||
NM_001083964.1 | Intron | NP_001077433.1 | ||||
NM_001083965.1 | Intron | NP_001077434.1 | ||||
NM_006862.3 | Intron | NP_006853.2 | ||||
XM_005244856.4 | Intron | XP_005244913.1 | ||||
XM_017000122.1 | Intron | XP_016855611.1 | ||||
XM_017000123.1 | Intron | XP_016855612.1 | ||||
XM_017000124.1 | Intron | XP_016855613.1 | ||||
XM_017000125.1 | Intron | XP_016855614.1 | ||||
XM_017000126.1 | Intron | XP_016855615.1 | ||||
XM_017000127.1 | Intron | XP_016855616.1 | ||||
XM_017000128.1 | Intron | XP_016855617.1 | ||||
XM_017000129.1 | Intron | XP_016855618.1 | ||||
XM_017000130.1 | Intron | XP_016855619.1 |