Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAGGACGCAGGCGGCCACGGCCA[A/G]GAGGACGACGGTCAGCCACCCAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 603905 MIM: 600315 | ||||||||||||||||||||
Literature Links: |
TNFRSF18 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TNFRSF18 - TNF receptor superfamily member 18 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004195.2 | 649 | Silent Mutation | CTG,TTG | L,L 171 | NP_004186.1 | |
NM_148901.1 | 649 | Intron | NP_683699.1 | |||
NM_148902.1 | 649 | Silent Mutation | CTG,TTG | L,L 171 | NP_683700.1 | |
XM_017002722.1 | 649 | Silent Mutation | CTG,TTG | L,L 171 | XP_016858211.1 |
TNFRSF4 - TNF receptor superfamily member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTLL10 - tubulin tyrosine ligase like 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |