Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCAGCGTCTCCTTCCCACCCTCCA[C/T]GGAGTACTGGTGAAAGTTCTTGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 601989 MIM: 607986 | ||||||||||||||||||||
Literature Links: |
S100A13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
S100A13 - S100 calcium binding protein A13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A14 - S100 calcium binding protein A14 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020672.2 | 304 | Missense Mutation | NP_065723.1 | |||
XM_005245362.1 | 304 | Missense Mutation | XP_005245419.1 | |||
XM_017001875.1 | 304 | Missense Mutation | XP_016857364.1 |
S100A16 - S100 calcium binding protein A16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |