Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGTTCTCTGGGGAGGAAGAGGAC[A/G]AACAGATGTTCTCAGCCATGTCCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 605551 | ||||||||||||||||||||
Literature Links: |
C1orf111 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1orf111 - chromosome 1 open reading frame 111 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182581.3 | 483 | Missense Mutation | TCG,TTG | S,L 140 | NP_872387.2 | |
XM_005245103.3 | 483 | Missense Mutation | TCG,TTG | S,L 102 | XP_005245160.1 | |
XM_011509443.2 | 483 | Missense Mutation | TCG,TTG | S,L 159 | XP_011507745.1 | |
XM_011509444.1 | 483 | Missense Mutation | TCG,TTG | S,L 90 | XP_011507746.1 | |
XM_011509445.2 | 483 | Intron | XP_011507747.1 |
C1orf226 - chromosome 1 open reading frame 226 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOS1AP - nitric oxide synthase 1 adaptor protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |