Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTCAAGAAGAATTGGGTGCTCCC[G/T]GGTAGTAAATACCTAAAAATGATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
LOC101927560 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101927560 - uncharacterized LOC101927560 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927587 - uncharacterized LOC101927587 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTLL7 - tubulin tyrosine ligase like 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024686.4 | 2727 | Silent Mutation | CCA,CCC | P,P 852 | NP_078962.4 | |
XM_005271208.2 | 2727 | Silent Mutation | CCA,CCC | P,P 825 | XP_005271265.1 | |
XM_011542159.2 | 2727 | Intron | XP_011540461.1 | |||
XM_017002347.1 | 2727 | Silent Mutation | CCA,CCC | P,P 852 | XP_016857836.1 | |
XM_017002348.1 | 2727 | Intron | XP_016857837.1 | |||
XM_017002349.1 | 2727 | Silent Mutation | CCA,CCC | P,P 607 | XP_016857838.1 |