Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCCCGAACAAAACACCAGTCAAC[G/A]CTGATGGGCTGTCCCATCAAATCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 612875 MIM: 603867 MIM: 605313 | ||||||||||||||||||||
Literature Links: |
GNRHR2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GNRHR2 - gonadotropin releasing hormone receptor 2 (pseudogene) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIX1L - limb and CNS expressed 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PEX11B - peroxisomal biogenesis factor 11 beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RBM8A - RNA binding motif protein 8A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005105.4 | Intron | NP_005096.1 |