Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGGGAGCCCGGGGCAGCCCCCCGC[G/T]CAGTCACCACGACGCGGCACCCGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
8 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 609607 MIM: 613466 | ||||||||||||||||||||
Literature Links: |
KLHDC9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLHDC9 - kelch domain containing 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007255.2 | 381 | Missense Mutation | CGC,CTC | R,L 79 | NP_001007256.1 | |
NM_152366.4 | 381 | Missense Mutation | CGC,CTC | R,L 79 | NP_689579.3 |
NECTIN4 - nectin cell adhesion molecule 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PFDN2 - prefoldin subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |