Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTATTCCTCCTACTCTCTCTCTTC[A/G]TCTTTTCCCACCTCCCCAGTGAACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607629 MIM: 615782 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
APH1A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
APH1A - aph-1 homolog A, gamma-secretase subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C1orf54 - chromosome 1 open reading frame 54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CIART - circadian associated repressor of transcription | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300838.1 | 128 | Silent Mutation | TCA,TCG | S,S 17 | NP_001287767.1 | |
NM_001300839.1 | 128 | Intron | NP_001287768.1 | |||
NM_001300840.1 | 128 | Intron | NP_001287769.1 | |||
NM_001300841.1 | 128 | Intron | NP_001287770.1 | |||
NM_144697.3 | 128 | Silent Mutation | TCA,TCG | S,S 17 | NP_653298.1 | |
XM_017000378.1 | 128 | UTR 5 | XP_016855867.1 |