Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCCAGCCCAAGATGATTCCAGCA[A/G]TGGTCTTGCTCTTACTCCTTTTGGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
16 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 107670 MIM: 147139 MIM: 602985 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
APOA2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
APOA2 - apolipoprotein A2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FCER1G - Fc fragment of IgE receptor Ig | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004106.1 | 38 | Missense Mutation | ATG,GTG | M,V 5 | NP_004097.1 |
NDUFS2 - NADH:ubiquinone oxidoreductase core subunit S2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166159.1 | 38 | Intron | NP_001159631.1 | |||
NM_004550.4 | 38 | Intron | NP_004541.1 | |||
XM_005245208.2 | 38 | Intron | XP_005245265.1 | |||
XM_005245209.1 | 38 | Intron | XP_005245266.1 | |||
XM_017001357.1 | 38 | Intron | XP_016856846.1 |