Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCAGGGGGCGAGGCTTACATTGTC[A/G]TTCTGAAAGGAGTGGAGGAAGTTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611843 MIM: 607390 | ||||||||||||||||||||
Literature Links: |
MRPL37 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MRPL37 - mitochondrial ribosomal protein L37 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSBP3 - single stranded DNA binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001009955.3 | 1458 | Silent Mutation | AAC,AAT | N,N 350 | NP_001009955.1 | |
NM_018070.4 | 1458 | Silent Mutation | AAC,AAT | N,N 357 | NP_060540.2 | |
NM_145716.3 | 1458 | Silent Mutation | AAC,AAT | N,N 377 | NP_663768.1 | |
XM_006710545.3 | 1458 | Silent Mutation | AAC,AAT | N,N 330 | XP_006710608.1 | |
XM_017000897.1 | 1458 | Silent Mutation | AAC,AAT | N,N 267 | XP_016856386.1 | |
XM_017000898.1 | 1458 | Silent Mutation | AAC,AAT | N,N 267 | XP_016856387.1 | |
XM_017000899.1 | 1458 | Silent Mutation | AAC,AAT | N,N 240 | XP_016856388.1 |
SSBP3-AS1 - SSBP3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |