Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAACAAGATGCAACAGAAATCACAG[A/T]AGAAAGCAGAACTTCTTGATAATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606186 MIM: 611978 MIM: 609238 | ||||||||||||||||||||
Literature Links: |
CACYBP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACYBP - calcyclin binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007214.1 | 520 | Nonsense Mutation | AAG,TAG | K,* 7 | NP_001007215.1 | |
NM_014412.2 | 520 | Nonsense Mutation | AAG,TAG | K,* 50 | NP_055227.1 | |
XM_017001046.1 | 520 | Nonsense Mutation | AAG,TAG | K,* 7 | XP_016856535.1 |
LOC105371622 - uncharacterized LOC105371622 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS14 - mitochondrial ribosomal protein S14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RABGAP1L - RAB GTPase activating protein 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |