Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGAATAGCCACAGATGAGTGTTCA[C/T]CCCCTGCCAAAACTAACAAATGCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610956 MIM: 608280 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DARS2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DARS2 - aspartyl-tRNA synthetase 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAS5 - growth arrest specific 5 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAS5-AS1 - GAS5 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA103 - small nucleolar RNA, H/ACA box 103 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD44 - small nucleolar RNA, C/D box 44 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD47 - small nucleolar RNA, C/D box 47 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD74 - small nucleolar RNA, C/D box 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD75 - small nucleolar RNA, C/D box 75 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD76 - small nucleolar RNA, C/D box 76 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD77 - small nucleolar RNA, C/D box 77 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD78 - small nucleolar RNA, C/D box 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD79 - small nucleolar RNA, C/D box 79 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD80 - small nucleolar RNA, C/D box 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD81 - small nucleolar RNA, C/D box 81 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB37 - zinc finger and BTB domain containing 37 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |