Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACAGTGTCACGATGTCAGCGTTGG[C/T]CGCCTGCACTGCGATGGCCAACGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
12 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601328 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACAP3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACAP3 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030649.2 | 4885 | Missense Mutation | ACC,GCC | T,A 780 | NP_085152.2 | |
XM_005244715.2 | 4885 | Missense Mutation | ACC,GCC | T,A 747 | XP_005244772.1 | |
XM_005244717.3 | 4885 | Missense Mutation | ACC,GCC | T,A 439 | XP_005244774.1 | |
XM_011540606.2 | 4885 | Missense Mutation | ACC,GCC | T,A 790 | XP_011538908.1 | |
XM_011540607.1 | 4885 | Missense Mutation | ACC,GCC | T,A 790 | XP_011538909.1 | |
XM_011540608.2 | 4885 | Missense Mutation | ACC,GCC | T,A 758 | XP_011538910.1 | |
XM_011540609.2 | 4885 | Missense Mutation | ACC,GCC | T,A 757 | XP_011538911.1 | |
XM_017000233.1 | 4885 | Missense Mutation | ACC,GCC | T,A 591 | XP_016855722.1 |
MIR6726 - microRNA 6726 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCNN1D - sodium channel epithelial 1 delta subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |